BIO

CURRICULUM:

Standards, Benchmarks
Coteaching with Mrs. Peth









MOLECULAR GENETICS QUIZ

Discovered bacterial transformation:

Two time Nobel prize winner. Built and incorrect model of DNA that had three strands:

Determined that DNA was the genetic material using bacteriophages:

Reproduced Griffeth's experiment, but removed certain parts of the pneumonia causing bacteria. Provided evidnece for DNA being the genetic material:

Made the first correct model of DNA:

Determined that Adenine pairs with Thymine and that Guanine pairs with Cytosine:

Produced the X-Ray's that determined the shape of the DNA molecule:

The process of DNA making more DNA:

The production of a protein is called:

DNA being copied to make RNA is called:

Which of the following will be the complementary strand of DNA for this DNA sequence?
AGCTCTAGATCGAGGTACTG

Which of the following will be the complementary strand of RNA for this DNA sequence?
AGCTCTAGATCGAGGTACTG

Where is DNA located?

Where is RNA located?

Where Translation happen?


Email Mr. Mugan | Last Updated August 1, 2004. | Strive to be happy!
Copywrite 2004, Paul Mugan. All rights reserved | Permission for free use is given for educational purposes.
I highly recommend Intermediate Web Design taught by Jim Erbe online through UW Stout
Thanks: cooltext.com | flashbuttons.com | flamingtext.com | dynamicdrive.com | quia.com